|
 
 |
| ORIGINAL RESEARCH |
|
| Year : 2023 | Volume
: 15
| Issue : 1 | Page : 89-96 |
|
Comparative evaluation of the antibacterial efficacy of herbal agents as intracanal medicaments individually or in combination with chitosan: An in vitro RTPCR study
Gaurav Patri, Kotni Sheetal, Prasanti Kumar Pradhan, Pratik Agrawal, S Lata
Department of Conservative Dentistry and Endodontics, Kalinga Institute of Dental Sciences, KIIT Deemed to Be University, Bhubaneswar, Odisha, India
| Date of Submission | 19-Jul-2022 |
| Date of Decision | 11-Nov-2022 |
| Date of Acceptance | 27-Nov-2022 |
| Date of Web Publication | 28-Feb-2023 |
Correspondence Address:
Dr. Gaurav Patri
Department of Conservative Dentistry and Endodontics, Kalinga Institute of Dental Sciences, KIIT Deemed to Be University, Bhubaneswar, Odisha
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/jioh.jioh_154_22
Aim: To evaluate and compare the antimicrobial efficacy of herbal agents as intracanal medicaments with or without a carrier against E. faecalis. Materials and Methods: In this in vitro study, 80 extracted human single-rooted anterior or premolar teeth were used. They were decoronated to obtain standardized 6 mm blocks of the mid root. The internal root diameter was standardized(GG drill #3). All samples underwent 21-day contamination with E. faecalis after which they were randomly divided into(n = 20) Group 1, Triple antibiotic paste (Control); Group 2, Curcumin; Group 3, Propolis and Group 4, Aloe Vera gel. The groups were further sub grouped(n = 10) based on presence / absence of carrier (chitosan). 14 days post medication, E. faecalis from samples was quantified using qPCR and the data was analysed using One-way ANOVA and Tukeys Post-Hoc test. Results: All medicaments exhibited antimicrobial properties. TAP performed the best, Individually, Propolis showed almost similar efficacy (P = 0.598). With chitosan combination, Curcumin was a close contender to TAP (P = 0.963). Aloe Vera gave the poorest result, but on addition of chitosan there was a significant increase (P = 0.000) in the antimicrobial efficacy. Conclusion: Based on the aim and the results obtained it can be concluded that all the test medicaments exhibited antimicrobial properties. TAP had superior antimicrobial properties compared to others. Individually, propolis and in combination with chitosan, curcumin showed similar antimicrobial efficacy. Aloe vera performed the poorest but when combined with chitosan, its antimicrobial properties significantly improved. Keywords: Aloe Vera, Chitosan, Curcumin, E. Faecalis, Propolis
How to cite this article:
Patri G, Sheetal K, Pradhan PK, Agrawal P, Lata S. Comparative evaluation of the antibacterial efficacy of herbal agents as intracanal medicaments individually or in combination with chitosan: An in vitro RTPCR study. J Int Oral Health 2023;15:89-96 |
How to cite this URL:
Patri G, Sheetal K, Pradhan PK, Agrawal P, Lata S. Comparative evaluation of the antibacterial efficacy of herbal agents as intracanal medicaments individually or in combination with chitosan: An in vitro RTPCR study. J Int Oral Health [serial online] 2023 [cited 2023 Apr 1];15:89-96. Available from: https://www.jioh.org/text.asp?2023/15/1/89/370745 |
| Introduction | |  |
Endodontic success primarily relies on the complete eradication of microorganisms from the infected canals.[1] The evidence of microbial persistence in endodontic failure cases is about 35 - 100%, amidst which E. Faecalis association is 29 -77%.[2] Interappointment canal medication effectively supplements chemomechanical preparation for optimum canal disinfection.[1] The broad spectrum activity of the medicaments eradicates deep-seated microorganisms within the dentinal tubules that have previously survived due to their virulence factor or the biofilm.[2] These medicaments to be effective have to remain in the canal for a predefined period in which controlled slow release of the drug has been proven to be more efficacious.[2]
Triple antibiotic paste(TAP) and calcium hydroxide amongst others are routinely used medicaments in retreatment and regenerative endodontics.[3] These chemical medicaments are analogous with certain misgivings such as their inherent side effects, cytotoxicity, misuse or overuse, and detrimental effect on apical stem cells.[1] To counteract these pernicious effects, herbal products are gradually gaining momentum as they exhibit fewer side effects and toxicity, have low microbial resistance, and are inexpensive and easily available.[1]
Curcumin, an integral constituent of Curcuma Longa is instrumental for its biological activities. Besides other therapeutic attributes, curcumin demonstrates potent antimicrobial and antiviral properties. It inhibits bacterial cell division and is proven effective against E. Faecalis.[1]
Propolis (Bee glue), a herbal agent has flavonoids and cinnamic acid derivatives as their active components for their various curative properties. Propolis has shown to be effective against resistant microorganisms and was more congruous with the periapical tissues than the traditional intracanal medicaments.[1],[4]
Aloe vera extract exhibits antibacterial properties as it possesses anthraquinones and 75 other active ingredients. As an intracanal medicament, it is antibacterial, biocompatible, and exhibits minimal toxicity to the periradicular tissues.[5],[6],[7]
One of the most important prerequisites of an intracanal medicament is stability and sustained release of the medicament for a prolonged duration of time. Chitosan, a biopolymer produced by the partial deacetylation of chitin can be used as a drug carrier where it enables a slow and controlled release of intracanal medicament.[3],[8] It also exhibits bio-adhesive properties and minimal toxicity.[8]A vehicle can accentuate the antibacterial attributes of an intracanal medicament.[9]
Alternatives need to be explored for TAP substitution in elimination of persistent microbes from the root canal owing to its disadvantages. Literature reveals limited information on the use of herbal agents as intracanal medicaments. Its efficacy with chitosan supplementation as a vehicle is less documented. Furthermore, the use of RT-PCR, as a substitute to traditional immunoassay-based or culture-based testing methods due to its superior sensitivity, specificity, minimal contamination risk, performance ease, and speed to determine the efficacy of intracanal medicaments, is uncommon.[10]
Thus, the aim of this research was to objectively assess and compare the antibacterial efficacy of curcumin, propolis, and aloe vera with triple antibiotic paste, individually and in combination with chitosan as a carrier against Enterococcus faecalis using qRT-PCR.
The null hypothesis is that the herbal agents alone or in combination with chitosan did not have antibacterial activity against E. Faecalis.
| Materials and Methods | | |
This in vitro study was conducted between 1st august 2021 to 31st October 2021 in kalinga institute of dental sciences, Bhubaneswar. Ethical clearance was obtained by institutional ethical clearance committee (KIIT/ KIMS/ IEC/ 178/ 2019). The extracted teeth used in this study was sourced from department of oral and maxillofacial surgery, kalinga institute of dental sciences, Bhubaneswar.
Inclusion and exclusion criteria
Intact single-rooted human maxillary anterior teeth /mandibular anterior and mandibular premolar teeth with a single canal, extracted for periodontal/therapeutic reasons without extensive carious lesions, fracture, developmental anomaly and resorption were included in the study. Teeth with caries, multiple canals, fracture, restoration, morphological or developmental anomaly and resorption were excluded.
Sample size estimation and sampling technique
Sample size estimation was done using GPower software (version 3.0), α
err prob = 0.05 Power (1−β err prob) = 0.8. A minimum total sample size of 72(18 per group) was found to be sufficient for an alpha of 0.05, confidence limit of 95% and 0.50 effect size (assessed for difference in threshold cycle values). Thus, to round off the samples in each group, 20 samples per each major group and 10 samples for a subgroup was selected. Thus, the total final sample size was of 80 and simple random sampling method was used to allocate teeth to respective groups.
Preparation of dentin blocks
Haapasalo and Orstavik’s[11] proposed model was modified and 80 freshly extracted human single-rooted anterior or premolar teeth with intact cementum were used in this study. The teeth were decoronated with a rotary diamond disk to obtain standardized 6 mm blocks of the mid root. For internal root diameter standardization, gates glidden drill no.3 (Mani Inc.) was used. The blocks were treated in an ultrasonic bath (17% EDTA/ 5 minutes, 3% sodium hypochlorite/ 5 minutes, and distilled water/ 5 minutes) for debris and chemical removal. The blocks were then autoclaved for sterilization.[12]
Sample contamination
In this study, the test organism used was E. faecalis (ATCC 29212). Under laminar flow, E. faecalis (24-hour pure colony) was cultured on TS agar, suspended in TS broth (5 ml), and incubated (370C/ 4 hours). The turbidity of the culture suspension was calibrated to match 0.5 McFarland standard turbidity. Then, into the microcentrifuge tubes, that contained a dentin block and TS broth (1ml), the inoculum (50 µL) was transferred. The dentin blocks were relocated every other day into broths containing fresh E. faecalis cultures. The culture purity was determined by subculturing the broth (5 µL) from the tubes on TSA plates. All samples underwent 21-day contamination.[12]
Test agents fabrication
Triple antibiotic paste preparation: (2 mg/mL)
Following Hoshino et al.,[13]tablets of ciprofloxacin(Ciplox, Cipla), metronidazole(Metrogyl, J. B. Chemicals and Pharmaceuticals Ltd.) and minocycline((Minoz, Cipla) was powdered manually with a mortar and pestle, filtered through a fine sieve to retain the fine powder. To obtain the mixture, the powders were weighed separately and mixed in a ratio of 1:3:3. 20 mg of this powder mixture was then dissolved in 10mL distilled water to form a TAP mixture concentration of 2 mg/mL.
Curcumin extract preparation: (2 mg/ml)
20 mg of curcumin (Himedia) was dissolved in 5mL dimethyl sulphoxide and then this mixture was added to 5mL distilled water to make 10mL of curcumin extract. The prepared extract was kept in a magnetic stirrer at 700 rpm for 48 hours.
Propolis extract preparation:(2 mg/ml)
200 mg of propolis (YS Eco Bee, USA) was dissolved in 100 mL distilled water and this mixture was boiled for 10–15 minutes using heating mantle at 60- 70° C. The prepared extract was filtered using Whatmann No:1 filter paper and the filtered extract was further concentrated to 5mL by using the heating mantle.
Aloe vera gel
Fresh leaves of aloe vera were taken and washed thoroughly under tap water. Fresh aloe vera gel was scooped out of the leaf. The 10g of the scooped gel was uniformly crushed using mortar and pestle to form a gel-like consistency.
Chitosan preparation
250 mg of chitosan((Himedia) was measured and dissolved with 0.5mL of glacial acetic acid. To that, 24.5mL of distilled water was added. The chitosan solution was kept in a magnetic stirrer at 700 rpm for 48 hours.
Test agents with chitosan vehicle
To 25mL of chitosan solution, 5mL of prepared test agent was added. The resultant solution was kept in a magnetic stirrer at 700 rpm for 48 hours.
All test agents that were in solution form were magnetically stirred to thicken it to gel like consistency for easy application.
Antimicrobial assessment
After 21 days, the blocks underwent irrigation with sterile saline (5 mL) to wash out the broth. The samples were divided at random into the following groups(n = 20). Group 1, Triple antibiotic paste (Control); Group 2, Curcumin; Group 3, Propolis and Group 4, Aloe Vera gel. Based on the Vehicle used, the groups were further subdivided (n = 10) into subgroup A (test agent + distilled water) and subgroup B (Test agent + chitosan). [Figure 1] | Figure 1: Test agents and methodology representation. a- Aloe vera gel, b- Aloe vera + chitosan, c- TAP + chitosan, d- TAP + saline, e- Propolis extract, f- Propolis+ chitosan, g- Curcumin extract, h- Curcumin+ chitosan
Click here to view |
The medicaments were introduced into the root canal with a lentulospiral. Paraffin wax was used to seal the canal from both ends. The blocks were then incubated (14 days/ 37°C)in an anaerobic environment. After 14 days, they were finally rinsed with saline(5ml) for medicament removal.[12] Then the dentine was harvested at 400 µm depth with a sterile Gates-Glidden drill no. 5, following which genomic DNA was extracted from E. faecalis using Purelink genomic DNA mini Kit, (Invitrogen, USA) and recorded (electrophoretogram) using MegaCapt software.[Figure 2] | Figure 2: High genomic isolation, amplification and qRT PCR. a- High molecular genomic DNA isolation from E. Faecalis, b- Agarose gel electrophoregram of amplified genomic DNA, 2c and d – Amplification plot demonstrating different Ct values
Click here to view |
Following DNA isolation and amplification, the specimens were then analyzed using quantitative real-time PCR (Biorad Laboratories Inc, USA) that measured the starting quantity (Sq) of the amount of bacterial DNA sustained in the sample.[Figure 2] Primers used for quantification included a forward primer(EFASpF: GGGGACAGTTTTGGATGCTA) and a reverse primer (EFASpR: ATTTAACTGAGGCAATGGCG). The assay was performed (95˚C for 3 min, 39 cycles of 95˚C for 10s, and 54˚C for 3 min annealing temperature) using Biorad CFX96 thermal cycling system. At the end of the extension step of every cycle, Fluorescence signals were measured and the resulting data were analyzed using CFX Maestro Software, BioRad, California, USA.[2]
Statistical analysis
Statistical analysis of the starting quantity (Sq) values of all test samples was done with SPSS 26.0 (SPSS Inc.; Chicago,IL, USA). Intra-group and inter-group comparison was carried out using One-way ANOVA and Tukeys Post-Hoc test. The study’s confidence level was set at 95%, so P < 0.05 was considered statistically significant.
| Results | | |
The antimicrobial efficacy of the test materials against E. faecalis was assessed by measuring the starting quantity (Sq) via qRT-PCR test that detected the amount of bacterial DNA sustained in the sample. The results were analysed after obtaining the starting quantity values of all the test samples at the end of 14 days via qRT-PCR.
[Table 1] summarizes the mean, standard deviation and the confidence interval for mean of all the experimental groups. On the basis of the overall results, all test groups demonstrated antibacterial activity against E. faecalis. TAP + chitosan group and aloe vera group showed the best and the least effective results respectively. | Table 1: Descriptive statistics including mean and standard deviation of Sq values for all groups
Click here to view |
[Table 2] presents the intra-group comparison amongst all test groups. The addition of chitosan resulted in an increase in the antibacterial efficacy in all the test groups, however, the differences were not statistically significant (p-value >0.05) except in Group IV (Aloe vera) where a statistically significant difference was observed (p-value=0.000).
[Table 3] shows the inter-group comparison of all groups individually without a carrier. Group Ia (TAP /control) performed best. The herbal medicament that was a close contender to Group Ia was Group IIIa (Propolis) and the difference was not statistically significant (p-value = 0.598). Group IVa (Aloe vera) consistently performed poorly than all the other groups and the differences were statistically significant (p-value = 0.000). | Table 3: Inter-group comparison of all the experimental groups without carrier
Click here to view |
[Table 4] depicts the inter-group comparison of all groups with chitosan carrier. Group Ib (TAP + chitosan) performed the best. The herbal medicament that was a close contender to Group Ib was Group IIb (Curcumin + chitosan), although the difference was not statistically significant (p-value = 0.963). Group IIIb (propolis + chitosan) performed the worst, however, these differences were not statistically significant. (p-value >0.05). Chitosan addition to Aloe vera (Group IVb) increased its antibacterial efficacy from poor performance (Group IVa) to comparable to that other high performing groups. | Table 4: Inter-group comparison of all the experimental groups with chitosan as a carrier
Click here to view |
| Discussion | | |
In this study, human teeth were employed, which was a modification of the tooth model proposed by Haapasalo and Ostravik[11] to better imitate the clinical setting.[12],[14]
Based on molecular analyses, endodontic treatment failure is primarily caused by E. faecalis, a gram-positive facultative anerobic bacteria.[15] Thus, E. faecalis was chosen for our investigation. As mature E. faecalis biofilms in root canals are more resistant to disinfecting solutions than younger biofilms, the efficiency of the intracanal medicaments was investigated against a 21-day mature E. faecalis biofilm.[8]PCR-based detection technologies, with its high sensitivity and specificity, may quickly identify both cultivable and noncultivable microbial species. Under severe environmental conditions, the enterococcal cells lose their culturability but remain viable. This can be detected under PCR assays.[15] Hence, qPCR,a sensitive molecular approach was adopted in this study.
TAP results in a substantial decrease in the mechanical properties of root dentin and has demonstrated toxicity to apical papilla stem cells when used at higher concentrations. As a result, the recommended concentration is 0.1-2 mg/mL to resolve the detrimental cytotoxicity. Thus, in this study, TAP was used at a concentration of 2 mg/ml. The other test agents were also prepared at the same concentration to standardize the study protocol.[16]
Propolis, curcumin, and aloe vera are common herbal agents that can be obtained inexpensively and are proven antibacterial agents with extensive research. As intracanal medications, their efficacy has not been compared amongst themselves, nor has their combination with chitosan, which was thus undertaken in this study. As the mainstay of this study was to compare the antimicrobial efficacy of herbal agents, it was thus compared with a synthetic counterpart,TAP, a broad spectrum antimicrobial agent and the gold standard in intracanal medication.
In our study, intra-group comparisons [Table 2] revealed that adding chitosan increased antibacterial efficacy against E. faecalis in all test groups, but these differences were not significant, statistically (p-value >0.05) except in Group IV (Aloe vera), where a significant difference (p-value=0.000) was observed. The findings of Shaik J et al.,[17] Alven S et al.,[18] Parolia A et al.,[8] and Ranjbar R et al.,[19]are in agreement with the findings in this study. The increased antimicrobial action of the test groups in which chitosan is included could be linked to the potentiating influence of chitosan as an antibacterial agent and a drug carrier onto the already established antibacterial test agent.[8],[17] Chitosan’s positively charged NH3 glucosamine groups interact with bacteria’s negatively charged surface components, resulting in widespread cell surface attraction, intracellular substance loss, and bacterial cell death. Chitosan, as a drug carrier, provides the advantages of gradual and governed drug release, which improves medication miscibility, stability, potency, and reduces toxicity.[8],[17]
In our study, on inter-group comparisons[Table 3], it was inferred that, without a vehicle, Group Ia (TAP) (control) performed the best in terms of antibacterial efficacy against E. faecalis. This is in accordance with findings of Manisha Choudary T. et al.[20] The combination of the antibiotics in TAP, seems to be able to defeat bacterial resistance by exerting a broad spectrum antimicrobial action.[21] Its superiority might also be attributed to metronidazole which is the most pharmacologically effective component in E. faecalis eradication; exerting its action through sustained release of its component.[22] The herbal medicament that was a close contender to Group Ia (TAP) against E. faecalis was Group IIIa (Propolis) and this difference was not statistically significant (p-value = 0.598). This finding is in accordance with Lillygrace E et al.,[23] Saha S et al.[1] and Vasudeva A et al.[24] The probable reason for this finding could be due to the antibacterial activity of propolis to alter the membrane permeability and membrane potential of E. faecalis thus reducing the resistance of these cells.[1] Additionally, the flavonoids components (quercetin, galangin, pinocembrin) from the propolis extract cause functional and structural damages to the cell wall.[23]
Group IVa (Aloe vera) consistently performed poorly against E. faecalis than all the other groups with a significant difference statistically (p-value = 0.000). This is consistent with the findings of Digole VR et al.,[25] Bazvand L et al.,[26] Vasudeva A et al.[24] The probable reason for this finding could be its inferior molecule binding ability to E. faecalis and inferior potential to alter its membrane permeability and structural integrity to thus reduce its resistance. Additionally, anthraquinones, the component of aloe vera may not be as effective against E faecalis as the other herbal agents used in this study.[7]
In our study, on inter-group comparison [Table 4] of all the experimental groups with chitosan as a carrier, it was inferred that, Group Ib (TAP + Chitosan) performed the best in terms of antibacterial efficacy against E. faecalis. It has been established previously that TAP performed the best among the test groups without a vehicle due to its broad-spectrum antibacterial action. Because of its synergistic action as an additional antibacterial agent and its role as an efficient drug carrier, the addition of chitosan to TAP increased antibacterial efficacy probably by boosting drug solubility, stability, and reducing overall toxicity.[17] The herbal medicament that was a close contender to Group Ib was Group IIb (Curcumin + Chitosan), although the difference was not statistically significant (p-value = 0.963). The possible reason for this finding could be that the combination of curcumin and chitosan resulted in a heightened synergistic effect by the possible integration of the antibacterial properties of curcumin and chitosan like inhibition of bacterial cell division, chelation and enzymatic inhibition.[1],[17]
Chitosan upon addition to Group IV (Aloe vera) [Table 4] increased the antibacterial efficacy of the group from its poor performing status (Group IVa) to a comparable status (Group IVb) (Aloe vera + Chitosan) as that of the other high performing groups. This discovery can be justified by the probable reason that the combination of anthraquinones present in aloe vera and chitosan with its antibacterial and effective drug carrier properties might be exhibiting coaction due to their higher collaborative and mutualistic effect, thus, proving to be highly efficacious as a potent intracanal medicament.[7],[17]
Group IIIb (Propolis + Chitosan) performed the worst,although the difference with other groups [Table 3]was not statistically significant (p-value >0.05). The possible reason for this finding could be that, although propolis and chitosan individually are potent antibacterial agents, their combination probably exhibited lesser synergistic effect than other groups.
Based on the overall results of the study, it can be summarised that All the test groups demonstrated antibacterial activity against E. faecalis. Individually, in terms of the antibacterial efficacy against E. faecalis, TAP (control) performed the best. The herbal medicament that was a close contender to TAP was propolis. Aloe vera performed poorly against E. faecalis than all the other groups.
Upon addition of chitosan, there was a resultant increase in the antibacterial efficacy against E. faecalis in all the test groups. TAP - Chitosan combination performed the best. Chitosan upon addition to Aloe vera gel significantly increased the antibacterial efficacy of the group from its poor performing status to a comparable status as that of the other high performing groups, whereas, the Propolis - Chitosan combination performed poorly than all the other groups. The herbal medicament that was a close contender to TAP - Chitosan combination was Curcumin - Chitosan combination.
The null hypothesis, that the herbal agents alone or in combination with chitosan did not have antibacterial activity against E. Faecalis is thus rejected based on the study findings.
The limitations of this study was that this in vitro study lacked the relevant clinical representation of an in vivo study. Furthermore, the antibacterial potential of the medicaments over time could have been assessed for better understanding of the stability of medicaments and their comparison with other routinely used intracanal medicaments could have undertaken.
| Conclusion | | |
Within the limitations of this study and based on the results obtained it can thus be concluded that against E. faecalis, all test groups demonstrated antibacterial activity. Individually and with chitosan, TAP performed the best. Propolis and curcumin – chitosan were close contender. Aloe vera consistently performed poorly, however, with addition of chitosan its antibacterial activity was comparable to the better performing groups.
| Future Scope | | |
Further in vivo studies are recommended using these medicaments in root canals and the antimicrobial potential of these medicaments can be tested against the polymicrobial endodontic biofilm.
| Clinical Significance | | |
Intracanal medicament are a prerequisite for thorough disinfection of the root canals. The possible side effects of conventional medicaments has created a niche for use of alternative medicine in root canal disinfection. This study demonstrates the successful use of various herbal agents as antibacterial agents against E. Faecalis, a common endodontic pathogen.
Acknowledgements
The authors wish to thank white lab, saveetha dental college and hospital, Chennai, for their technical assistance in conducting this study.
Financial support and sponsorship
This study was self-funded by the authors.
Conflicts of interest
There are no conflicts of interest.
Authors contribution
Manuscript preparation, editing and review by Gaurav Patri, Kotni Sheetal, Prasanti Kumar Pradhan, Pratik Agrawal, Lata S. Study concept by Gaurav Patri, Kotni Sheetal. Statistical analysis by Gaurav Patri, Kotni Sheetal. Experimental procedures by Gaurav Patri, Kotni Sheetal.
Ethical policy and institutional review board statement
This Research Received the Approval from institutional ethical clearance committee (KIIT/ KIMS/ IEC/ 178/ 2019).
Patient declaration of consent
Not applicable.
Data availability statement
Available on request (DR.Gaurav patri/[email protected])
| References | | |
| 1. | Saha S, Nair R, Asrani H Comparative evaluation of propolis, metronidazole with chlorhexidine, calcium hydroxide and curcuma longa extract as intracanal medicament against E. Faecalis–an invitro study. JCDR 2015;9:ZC19.  |
| 2. | Savitha A, SriRekha A, Vijay R, Ashwija , Champa C, Jaykumar T An in vivo comparative evaluation of antimicrobial efficacy of chitosan, chlorhexidine gluconate gel and their combination as an intracanal medicament against enterococcus faecalis in failed endodontic cases using real time polymerase chain reaction (qpcr). Saudi Dent J 2019;31:360-6. |
| 3. | Alfadda S, Alquria T, Karaismailoglu E, Aksel H, Azim AA Antibacterial effect and bioactivity of innovative and currently used intracanal medicaments in regenerative endodontics. J Endod 2021;47:1294-300. |
| 4. | Abdel Hafez E, Soliman AH Comparative Evaluation of the Antibacterial Effect of Triple Antibiotic Paste Versus Propolis as Intracanal Medicament. Egyptian Dental Journal 2019;65:825-30. |
| 5. | Varshini R, Subha A, Prabhakar V, Mathini P, Narayanan S, Minu K Antimicrobial efficacy of aloe vera, lemon, ricinus communis, and calcium hydroxide as intracanal medicament against Enterococcus faecalis: A confocal microscopic study. J Pharm Bioallied Sci 2019;11:256-9. |
| 6. | Bhardwaj A, Ballal S, Velmurugan N Comparative evaluation of the antimicrobial activity of natural extracts of morinda citrifolia, papain and aloe vera (all in gel formulation), 2% chlorhexidine gel and calcium hydroxide, against enterococcus faecalis: An in vitro study. J Conserv Dent 2012;15:293-7. |
| 7. | Ghasemi N, Behnezhad M, Asgharzadeh M, Zeinalzadeh E, Kafil HS Antibacterial properties of aloe vera on intracanal medicaments against enterococcus faecalis biofilm at different stages of development. Int J Dent 2020;2020:8855277. |
| 8. | Parolia A, Kumar H, Ramamurthy S, Davamani F, Pau A Effectiveness of chitosan-propolis nanoparticle against enterococcus faecalis biofilms in the root canal. Bmc Oral Health 2020;20:339. |
| 9. | Fava LR, Saunders WP Calcium hydroxide pastes: Classification and clinical indications. Int Endod J 1999;32:257-82. |
| 10. | Siqueira JF Jr, Rôças IN Exploiting molecular methods to explore endodontic infections: Part 1–current molecular technologies for microbiological diagnosis. J Endod 2005;31:411-23. |
| 11. | Haapasalo M, Orstavik D In vitro infection and disinfection of dentinal tubules. J Dent Res 1987;66:1375-9. |
| 12. | Krithikadatta J, Indira R, Dorothykalyani AL Disinfection of dentinal tubules with 2% chlorhexidine, 2% metronidazole, bioactive glass when compared with calcium hydroxide as intracanal medicaments. J Endod 2007;33:1473-6. |
| 13. | Hoshino E, Kurihara-Ando N, Sato I, Uematsu H, Sato M, Kota K, et al. In-vitro antibacterial susceptibility of bacteria taken from infected root dentine to a mixture of ciprofloxacin, metronidazole and minocycline. Int Endod J 1996;29:125-30. |
| 14. | Basrani B, Santos JM, Tjäderhane L, Grad H, Gorduysus O, Huang J, et al. Substantive antimicrobial activity in chlorhexidine-treated human root dentin. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002;94:240-5. |
| 15. | Eswar K, Venkateshbabu N, Rajeswari K, Kandaswamy D Dentinal tubule disinfection with 2% chlorhexidine, garlic extract, and calcium hydroxide against enterococcus faecalis by using real-time polymerase chain reaction: In vitro study. J Conserv Dent 2013;16:194-8. |
| 16. | Makandar SD, Noorani TY Triple antibiotic paste––Challenging intracanal medicament: A systematic review. J Int Oral Health 2020;12:189-96. |
| 17. | Shaik J, Garlapati R, Nagesh B, Sujana V, Jayaprakash T, Naidu S Comparative evaluation of antimicrobial efficacy of triple antibiotic paste and calcium hydroxide using chitosan as carrier against candida albicans and enterococcus faecalis: An in vitro study. J Conserv Dent 2014;17:335-9. |
| 18. | Alven S, Nqoro X, Aderibigbe BA Polymer-based materials loaded with curcumin for wound healing applications. Polymers 2020;12:2286. |
| 19. | Ranjbar R, Yousefi A Effects of aloe vera and chitosan nanoparticle thin-film membranes on wound healing in full thickness infected wounds with methicillin resistant staphylococcus aureus. Bull Emerg Trauma 2018;6:8-15. |
| 20. | Manisha Choudary T, Deosarkar B, Thakare PA Comparison of Antibacterial efficacy of Octenidine Dihydrochloride and Calcium Hydroxide, Triple Antibiotic Paste, Turmeric and Calcium Hydroxide as Anintracanal Medicaments against Enterococcus Faecalis:an in-Vitro Study. Int J Recent Sci Res 2018;9:28976-80. |
| 21. | Parhizkar A, Nojehdehian H, Asgary S Triple antibiotic paste: Momentous roles and applications in endodontics: A review. Restor Dent Endod 2018;43:e28. |
| 22. | El-Majeed A, Sara A, Nour El-deen MM, Rokaya ME, Sherif MM Comparative Evaluation of the Antibacterial Effect of Triple Antibiotic Paste Vesus Propolis as Intracanal Medicament. Al-Azhar Dental Journal for Girls 2020;7:1-6. |
| 23. | Lillygrace E, Kethineni B, Puppala R, Raichurkar HK, Ambati S, Saikiran KV Antimicrobial efficacy of triple antibiotic paste and propolis as an intracanal medicament in young permanent teeth: An in vivo study. Int J Clin Pediatr Dent 2021;14:243-8. |
| 24. | Vasudeva A, Sinha DJ, Tyagi SP, Singh NN, Garg P, Upadhyay D Disinfection of dentinal tubules with 2% chlorhexidine gel, calcium hydroxide and herbal intracanal medicaments against enterococcus faecalis: An in-vitro study. Singapore Dent J 2017;38:39-44. |
| 25. | Digole VR, Dua P, Shergill SP, Pathak P, Kumar V, Prakash P Comparative evaluation of antimicrobial efficacy of calcium hydroxide, curcumin and aloe vera as an intracanal medicament: An in-vivo study. IP Indian Journal of Conservative and Endodontics 2020;5:114-9. |
| 26. | Bazvand L, Aminozarbian MG, Farhad A, Noormohammadi H, Hasheminia SM, Mobasherizadeh S Antibacterial effect of triantibiotic mixture, chlorhexidine gel, and two natural materials Propolis and Aloe vera against Enterococcus faecalis: An ex vivo study. Dent Res J 2014;11:469. |
[Figure 1], [Figure 2]
[Table 1], [Table 2], [Table 3], [Table 4]
|
Search Pubmed for